Review



flag f1804  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Santa Cruz Biotechnology flag f1804
    (A) U2OS WT and SETX -KO cells <t>expressing</t> <t>Flag-PIF1,</t> with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B and C) U2OS WT and SETX -KO cells, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of <t>PCNA</t> (B) or ubiquitinated PCNA (C) with γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (E and F) U2OS SETX -KO cells expressing FLAG-PIF1 were infected with lentiviruses encoding shRNA-resistant PCNA-WT or PCNA-K164R. All cells were further infected with PCNA shRNA to deplete endogenous PCNA. Three days after PCNA knockdown, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of FLAG-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (G) U2OS SETX -KO cells with FLAG-PIF1 expression were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (H) U2OS SETX -KO EGFP-BIR reporter cells were infected with lentiviruses to express shRNA-resistant PCNA-WT or PCNA-K164R. Control cells and PCNA-expressing cells were infected with PCNA shRNA or vector. Three days later, all cells were infected with I-SceI-expressing lentiviruses to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after I-SceI induction, and data are shown as mean ± SD of n = 3 biological replicates.
    Flag F1804, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 6715 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+f1804/PCNA+Antibody/pmc12667547-371-9-11
    Average 96 stars, based on 6715 article reviews
    flag f1804 - by Bioz Stars, 2026-10
    96/100 stars

    Images

    1) Product Images from "Break-induced replication is activated to repair R-loop-associated double-strand breaks in SETX-deficient cells"

    Article Title: Break-induced replication is activated to repair R-loop-associated double-strand breaks in SETX-deficient cells

    Journal: Cell reports

    doi: 10.1016/j.celrep.2025.116386

    (A) U2OS WT and SETX -KO cells expressing Flag-PIF1, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B and C) U2OS WT and SETX -KO cells, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of PCNA (B) or ubiquitinated PCNA (C) with γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (E and F) U2OS SETX -KO cells expressing FLAG-PIF1 were infected with lentiviruses encoding shRNA-resistant PCNA-WT or PCNA-K164R. All cells were further infected with PCNA shRNA to deplete endogenous PCNA. Three days after PCNA knockdown, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of FLAG-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (G) U2OS SETX -KO cells with FLAG-PIF1 expression were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (H) U2OS SETX -KO EGFP-BIR reporter cells were infected with lentiviruses to express shRNA-resistant PCNA-WT or PCNA-K164R. Control cells and PCNA-expressing cells were infected with PCNA shRNA or vector. Three days later, all cells were infected with I-SceI-expressing lentiviruses to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after I-SceI induction, and data are shown as mean ± SD of n = 3 biological replicates.
    Figure Legend Snippet: (A) U2OS WT and SETX -KO cells expressing Flag-PIF1, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B and C) U2OS WT and SETX -KO cells, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of PCNA (B) or ubiquitinated PCNA (C) with γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (E and F) U2OS SETX -KO cells expressing FLAG-PIF1 were infected with lentiviruses encoding shRNA-resistant PCNA-WT or PCNA-K164R. All cells were further infected with PCNA shRNA to deplete endogenous PCNA. Three days after PCNA knockdown, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of FLAG-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (G) U2OS SETX -KO cells with FLAG-PIF1 expression were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (H) U2OS SETX -KO EGFP-BIR reporter cells were infected with lentiviruses to express shRNA-resistant PCNA-WT or PCNA-K164R. Control cells and PCNA-expressing cells were infected with PCNA shRNA or vector. Three days later, all cells were infected with I-SceI-expressing lentiviruses to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after I-SceI induction, and data are shown as mean ± SD of n = 3 biological replicates.

    Techniques Used: Expressing, Infection, shRNA, Knockdown, Control, Plasmid Preparation

    (A) U2OS WT and SETX -KO cells were infected with PRIM1 shRNA or vector. Three days later, cells were treated with IR (4 Gy) (left). U2OS WT and SETX -KO cells were treated with DMSO or CD437 (10 μM) prior to IR (4 Gy) (right). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B) U2OS SETX -KO cells were infected with the indicated shRNA or vector. Three days later, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (C) U2OS WT and SETX -KO cells (left), and SETX -KO cells infected with indicated shRNAs (right) were treated with IR (4 Gy). Two hours later, the co-localization of Polα and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells expressing Flag-PIF1, with or without RNASEH1 expression, were infected with XPF shRNA or vector. Three days later, all cells were treated with IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX (left) and the co-localization of FLAG-PIF1 and γ-H2AX (right) were analyzed by PLA. Data are shown as the mean of n = 100 cells. (E) U2OS EGFP-HR reporter cells were infected with vector, XPF shRNA, SETX shRNA, or both XPF shRNA and SETX shRNA. Three days later, cells were infected with lentiviruses expressing I-SceI to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after DSB induction; data are shown as mean ± SD of n = 3 biological replicates. (F) U2OS EGFP-HR reporter cells with or without RNASEH1 expression were infected with the indicated shRNAs. Three days later, cells were infected with lentiviruses expressing I-SceI to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after DSB induction, and data are shown as mean ± SD of n = 3 biological replicates.
    Figure Legend Snippet: (A) U2OS WT and SETX -KO cells were infected with PRIM1 shRNA or vector. Three days later, cells were treated with IR (4 Gy) (left). U2OS WT and SETX -KO cells were treated with DMSO or CD437 (10 μM) prior to IR (4 Gy) (right). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B) U2OS SETX -KO cells were infected with the indicated shRNA or vector. Three days later, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (C) U2OS WT and SETX -KO cells (left), and SETX -KO cells infected with indicated shRNAs (right) were treated with IR (4 Gy). Two hours later, the co-localization of Polα and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells expressing Flag-PIF1, with or without RNASEH1 expression, were infected with XPF shRNA or vector. Three days later, all cells were treated with IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX (left) and the co-localization of FLAG-PIF1 and γ-H2AX (right) were analyzed by PLA. Data are shown as the mean of n = 100 cells. (E) U2OS EGFP-HR reporter cells were infected with vector, XPF shRNA, SETX shRNA, or both XPF shRNA and SETX shRNA. Three days later, cells were infected with lentiviruses expressing I-SceI to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after DSB induction; data are shown as mean ± SD of n = 3 biological replicates. (F) U2OS EGFP-HR reporter cells with or without RNASEH1 expression were infected with the indicated shRNAs. Three days later, cells were infected with lentiviruses expressing I-SceI to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after DSB induction, and data are shown as mean ± SD of n = 3 biological replicates.

    Techniques Used: Infection, shRNA, Plasmid Preparation, Expressing

    Related Articles

    Western Blot:

    Article Title: ULK2 is essential for degradation of ubiquitinated protein aggregates and homeostasis in skeletal muscle
    Article Snippet: .. The following antibodies and respective dilutions were used for immunoblots: sequestosome1 (SQSTM1) (p62) (P0067, 1:1000),ULK1 (A7481, 1: 1000), FLAG (F1804, 1:1000) from MilliporeSigma, ULK2 (HPA009027, 1:500) from MilliporeSigma, next to breast cancer type 1 susceptibility protein gene 1 protein (NBR1) (sc-130380, 1:1000) from Santa Cruz Biotechnology (Dallas, TX, USA), LC3A/B (4108, 1:1000), ubiquitin (3936, 1:1000), cathepsin B (CTSB) (31718, 1:1000), lysosomal associated membrane protein 1 (LAMP1) (9091, 1:1000), autophagy related protein (Atg)13 (13273, 1:1000), Atg14 (5504, 1:1000), phosphorylated (p-)Atg14 (S29) (13155, 1:1000) from Cell Signaling Technology (Danvers, MA, USA), ULK2 (NBP1-33136, 1:500) from Novus Biologicals, p-p62 (S403) (MABC186-I, 1:1000) fromMilliporeSigma, p-Atg13 (S318) (600-401-C49S, 1:1000) from Rockland (Limerick, PA, USA), and 20S (ab22673, 1:1000) from Abcam (Cambridge, United Kingdom). ..

    Article Title: Proteomic analysis of ubiquitination substrates reveals a CTLH E3 ligase complex‐dependent regulation of glycolysis
    Article Snippet: Plasmid transfections were carried out with jetPRIME (Polypus Transfection, Illkirch, France) according to the manufacturer's protocol. pCDNA- FLAG- LDHA was created by PCR amplification (5ʹ GTACCAACCGGTA TGGCAACTCTAAAGGATC, 5ʹ GAAGGGTCTAGA TTAA ATTGCAGCTCCTTTTGGATCCC) of human LDHA cDNA (kind gift from Dr Rob Cumming) and cloned into pCDNA- FLAG (generated by digestion of muskelin of pCDNA- FLAG- MKLN1, described in Maitland et al16) via Age1 and XbaI digestion of both PCR product and vector. pCDNA- FLAGPKM2 was created in the same way (5ʹ AATGCAC CGGTAGCAAGCCCCATAGTGAAGCC, 5ʹ AAAAAGGCTAGCCGG CACAGGAACAACACGC) using PKM2 human cDNA (kind gift from Dr John Di Guglielmo), but with the PCR product digested with Age1 and NHE1. .. Antibodies used for western blot were: ARMC8 (E- 1, sc- 365307; Santa Cruz Biotechnology, Santa Cruz, CA, USA), FLAG (M2, F1804, Sigma- Aldrich, St. Louis, MO, USA), HA (HA- 7, H3663 Sigma- Aldrich), LDH (H- 10, sc- 133123, Santa Cruz), Muskelin (C- 12, sc- 398956, Santa Cruz Biotechnology), PKM (C- 11, sc- 365684, Santa Cruz), RanBPM (5 M, 71- 001, Bioacademia, Japan), and Vinculin (E1E9V, Cell Signaling Technology, Danvers, MA, USA). ..

    Article Title: The Robo4-TRAF7 complex suppresses endothelial hyperpermeability in inflammation.
    Article Snippet: For the detection of NF-κB, HUVECs were treated with TNFα for 30 or 60 min, and nuclear extract was prepared using the Qproteome Cell Compartment Kit (Qiagen). .. Western blotting was performed with the lysates and antibodies against Robo4 (N-17; Santa Cruz Biotechnology, Dallas, TX, USA, 1:100, AF2366; R&D systems, Minneapolis, MN, USA, 1:500), TRAF7 (H-300; Santa Cruz Biotechnology, 1:2000), FLAG (F1804; Sigma-Aldrich, 1:1000), VECadherin (F-8; Santa Cruz Biotechnology, 1:2000), Myc (9B11; Cell Signaling Technology, Danvers, MA, USA; 1:1000), NF-κBp65 (C-20: Santa Cruz Biotechnology, 1:2000), NF-κBp50 (H-119, Santa Cruz Biotechnology, 1:2000), LamineB2 (LN43, Abcam, Cambridge, UK 1:2000) and GAPDH (MAB374; Merck Millipore, 1:10000). ..

    Ubiquitin Proteomics:

    Article Title: ULK2 is essential for degradation of ubiquitinated protein aggregates and homeostasis in skeletal muscle
    Article Snippet: .. The following antibodies and respective dilutions were used for immunoblots: sequestosome1 (SQSTM1) (p62) (P0067, 1:1000),ULK1 (A7481, 1: 1000), FLAG (F1804, 1:1000) from MilliporeSigma, ULK2 (HPA009027, 1:500) from MilliporeSigma, next to breast cancer type 1 susceptibility protein gene 1 protein (NBR1) (sc-130380, 1:1000) from Santa Cruz Biotechnology (Dallas, TX, USA), LC3A/B (4108, 1:1000), ubiquitin (3936, 1:1000), cathepsin B (CTSB) (31718, 1:1000), lysosomal associated membrane protein 1 (LAMP1) (9091, 1:1000), autophagy related protein (Atg)13 (13273, 1:1000), Atg14 (5504, 1:1000), phosphorylated (p-)Atg14 (S29) (13155, 1:1000) from Cell Signaling Technology (Danvers, MA, USA), ULK2 (NBP1-33136, 1:500) from Novus Biologicals, p-p62 (S403) (MABC186-I, 1:1000) fromMilliporeSigma, p-Atg13 (S318) (600-401-C49S, 1:1000) from Rockland (Limerick, PA, USA), and 20S (ab22673, 1:1000) from Abcam (Cambridge, United Kingdom). ..

    Membrane:

    Article Title: ULK2 is essential for degradation of ubiquitinated protein aggregates and homeostasis in skeletal muscle
    Article Snippet: .. The following antibodies and respective dilutions were used for immunoblots: sequestosome1 (SQSTM1) (p62) (P0067, 1:1000),ULK1 (A7481, 1: 1000), FLAG (F1804, 1:1000) from MilliporeSigma, ULK2 (HPA009027, 1:500) from MilliporeSigma, next to breast cancer type 1 susceptibility protein gene 1 protein (NBR1) (sc-130380, 1:1000) from Santa Cruz Biotechnology (Dallas, TX, USA), LC3A/B (4108, 1:1000), ubiquitin (3936, 1:1000), cathepsin B (CTSB) (31718, 1:1000), lysosomal associated membrane protein 1 (LAMP1) (9091, 1:1000), autophagy related protein (Atg)13 (13273, 1:1000), Atg14 (5504, 1:1000), phosphorylated (p-)Atg14 (S29) (13155, 1:1000) from Cell Signaling Technology (Danvers, MA, USA), ULK2 (NBP1-33136, 1:500) from Novus Biologicals, p-p62 (S403) (MABC186-I, 1:1000) fromMilliporeSigma, p-Atg13 (S318) (600-401-C49S, 1:1000) from Rockland (Limerick, PA, USA), and 20S (ab22673, 1:1000) from Abcam (Cambridge, United Kingdom). ..

    Article Title: Dehydroglutathione, a glutathione derivative to introduce non-reversible glutathionylation
    Article Snippet: .. The membrane was blocked with 5 % BSA in Tris-buffered saline with 0.1% tween (TBST) and incubated with the following primary antibodies: FLAG (Sigma-Aldrich, F1804, 1:1000), glutathione (Virogen, 101-A-250, 1:1000), β-actin (Santa Cruz Biotechnology, sc-8432, 1:1000), GAPDH (Cell signaling, D4C6R, 1: 1000), and Lamin B1 (Cell signaling, D4Q4Z, 1: 1000). .. The membrane was then incubated with horseradish peroxidase (HRP)conjugated anti-mouse IgG (NA931V, Sigma, 1:1000) and anti-rabbit IgG, (NA934V, Sigma, 1:2000) to visualize the proteins by chemiluminescence (SuperSignal West Pico).

    Bioprocessing:

    Article Title: Ciliopathy protein HYLS1 coordinates the biogenesis and signaling of primary cilia by activating the ciliary lipid kinase PIPKIγ
    Article Snippet: .. Mouse monoclonal antibodies: acetylated α-tubulin (T7451), γ-tubulin (T6557), FLAG (F1804), and HA (H3663) are from Sigma-Aldrich; β-actin (sc-47778), Smoothened (SMO) (sc-166685), and HYLS1 (sc-376721) are from Santa Cruz Biotechnology; β-arrestin is from BD transduction Laboratories (610550); c-Myc is from Invitrogen (VB299757A); polyglutamylated tubulin is from Enzo Life Sciences (ALX-804-885-C100); ODF2 is from Abnova (H00004957-M01); and PI(4)P antibody is from Echelon (Z-P004). .. Mouse monoclonal NPHP1 antibody (immunoglobulin G1) was generated by Abmart as described previously ( ).

    Saline:

    Article Title: Dehydroglutathione, a glutathione derivative to introduce non-reversible glutathionylation
    Article Snippet: .. The membrane was blocked with 5 % BSA in Tris-buffered saline with 0.1% tween (TBST) and incubated with the following primary antibodies: FLAG (Sigma-Aldrich, F1804, 1:1000), glutathione (Virogen, 101-A-250, 1:1000), β-actin (Santa Cruz Biotechnology, sc-8432, 1:1000), GAPDH (Cell signaling, D4C6R, 1: 1000), and Lamin B1 (Cell signaling, D4Q4Z, 1: 1000). .. The membrane was then incubated with horseradish peroxidase (HRP)conjugated anti-mouse IgG (NA931V, Sigma, 1:1000) and anti-rabbit IgG, (NA934V, Sigma, 1:2000) to visualize the proteins by chemiluminescence (SuperSignal West Pico).

    Incubation:

    Article Title: Dehydroglutathione, a glutathione derivative to introduce non-reversible glutathionylation
    Article Snippet: .. The membrane was blocked with 5 % BSA in Tris-buffered saline with 0.1% tween (TBST) and incubated with the following primary antibodies: FLAG (Sigma-Aldrich, F1804, 1:1000), glutathione (Virogen, 101-A-250, 1:1000), β-actin (Santa Cruz Biotechnology, sc-8432, 1:1000), GAPDH (Cell signaling, D4C6R, 1: 1000), and Lamin B1 (Cell signaling, D4Q4Z, 1: 1000). .. The membrane was then incubated with horseradish peroxidase (HRP)conjugated anti-mouse IgG (NA931V, Sigma, 1:1000) and anti-rabbit IgG, (NA934V, Sigma, 1:2000) to visualize the proteins by chemiluminescence (SuperSignal West Pico).



    Similar Products

    99
    Cell Signaling Technology Inc flag f1804
    Flag F1804, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+f1804/HA-Tag+Rabbit+mAb/pm41611679-354-24-36
    Average 99 stars, based on 1 article reviews
    flag f1804 - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    94
    Novus Biologicals flag f1804
    CRISPR DDR library screening identifies the synthetic lethal effect between <t>SETX</t> and the SMC5/6 complex. ( A ) DDR screening results from MAGeCK analysis as described in the “Materials and methods” section. Genes are ranked by the RRA score of negative selection. ( B, C ) U2OS WT cells were infected with lentivirus encoding shRNA to knock down indicated genes. Three days after infection, cells were resuspended and seeded on new plates for colony formation assay (top) and monitoring growth speed (bottom). ( D ) U2OS WT cells were infected with shRNA-expressing lentivirus to deplete the indicated proteins. Three days after infection, cells were subjected to immunostaining with antibody <t>against</t> <t>γH2AX.</t> ( E ). U2OS WT cells with or without RNaseH1 expression were infected with SETX shRNA and SMC5 shRNA. Three days after infection, cells were subjected to immunostaining with antibody against γH2AX. ( F ). U2OS WT and SETX -KO cells were infected with SMC5 shRNA or vector. Three days after infection, cells were subjected to quantitative image-based cytometry (QIBC) analysis described in the “Materials and methods” section. The γH2AX level was displayed in different cell cycles (left). The percentage of cells with medium and high γH2AX signal was calculated and normalized to WT + vector control (right).
    Flag F1804, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+f1804/Senataxin+Antibody/pmc12802942-81-18-20
    Average 94 stars, based on 1 article reviews
    flag f1804 - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    98
    Proteintech flag f1804
    CRISPR DDR library screening identifies the synthetic lethal effect between <t>SETX</t> and the SMC5/6 complex. ( A ) DDR screening results from MAGeCK analysis as described in the “Materials and methods” section. Genes are ranked by the RRA score of negative selection. ( B, C ) U2OS WT cells were infected with lentivirus encoding shRNA to knock down indicated genes. Three days after infection, cells were resuspended and seeded on new plates for colony formation assay (top) and monitoring growth speed (bottom). ( D ) U2OS WT cells were infected with shRNA-expressing lentivirus to deplete the indicated proteins. Three days after infection, cells were subjected to immunostaining with antibody <t>against</t> <t>γH2AX.</t> ( E ). U2OS WT cells with or without RNaseH1 expression were infected with SETX shRNA and SMC5 shRNA. Three days after infection, cells were subjected to immunostaining with antibody against γH2AX. ( F ). U2OS WT and SETX -KO cells were infected with SMC5 shRNA or vector. Three days after infection, cells were subjected to quantitative image-based cytometry (QIBC) analysis described in the “Materials and methods” section. The γH2AX level was displayed in different cell cycles (left). The percentage of cells with medium and high γH2AX signal was calculated and normalized to WT + vector control (right).
    Flag F1804, supplied by Proteintech, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+f1804/Goat+anti-rabbit+IgG+(H%2BL)%2C+HRP+conjugate/pm41384861-77-87-88
    Average 98 stars, based on 1 article reviews
    flag f1804 - by Bioz Stars, 2026-10
    98/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology flag f1804
    (A) U2OS WT and SETX -KO cells <t>expressing</t> <t>Flag-PIF1,</t> with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B and C) U2OS WT and SETX -KO cells, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of <t>PCNA</t> (B) or ubiquitinated PCNA (C) with γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (E and F) U2OS SETX -KO cells expressing FLAG-PIF1 were infected with lentiviruses encoding shRNA-resistant PCNA-WT or PCNA-K164R. All cells were further infected with PCNA shRNA to deplete endogenous PCNA. Three days after PCNA knockdown, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of FLAG-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (G) U2OS SETX -KO cells with FLAG-PIF1 expression were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (H) U2OS SETX -KO EGFP-BIR reporter cells were infected with lentiviruses to express shRNA-resistant PCNA-WT or PCNA-K164R. Control cells and PCNA-expressing cells were infected with PCNA shRNA or vector. Three days later, all cells were infected with I-SceI-expressing lentiviruses to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after I-SceI induction, and data are shown as mean ± SD of n = 3 biological replicates.
    Flag F1804, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+f1804/PCNA+Antibody/pmc12667547-371-9-11
    Average 96 stars, based on 1 article reviews
    flag f1804 - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    94
    Cell Signaling Technology Inc flag f1804 200ug
    (A-A’) Immunoprecipitation of GSK3α/β-Flag with ALK WT , probed with <t>anti-Flag</t> (GSK3α/β) and anti-ALK. n=3 (B-B’) Immunoprecipitation of ALK-Flag with either GSK3α or GSK3β, 24h after cells were treated with 0.5μM crizotinib (CTN). DMSO was used as controls. Probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (C-D) Quantification of B-B’ using ImageJ. (E-G) Immunoprecipitation of ALK WT -Flag, ALK I1250T -Flag (kinase-dead), ALK F1174L -Flag, or ALK R1275Q -Flag with either GSK3α or GSK3β, probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (F-G) Quantification of E-E’ using ImageJ. *p<0.05, **p<0.001, ***p<0.0001, One-Way ANOVA. Each data point represents one biological repeat (n=3), error bars are standard deviation,
    Flag F1804 200ug, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+f1804/LSm2+Rabbit+mAb/bio_rxiv__2025__09__25__677354-172-29-25
    Average 94 stars, based on 1 article reviews
    flag f1804 200ug - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    96
    Santa Cruz Biotechnology flag f1804 200ug
    (A-A’) Immunoprecipitation of GSK3α/β-Flag with ALK WT , probed with <t>anti-Flag</t> (GSK3α/β) and anti-ALK. n=3 (B-B’) Immunoprecipitation of ALK-Flag with either GSK3α or GSK3β, 24h after cells were treated with 0.5μM crizotinib (CTN). DMSO was used as controls. Probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (C-D) Quantification of B-B’ using ImageJ. (E-G) Immunoprecipitation of ALK WT -Flag, ALK I1250T -Flag (kinase-dead), ALK F1174L -Flag, or ALK R1275Q -Flag with either GSK3α or GSK3β, probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (F-G) Quantification of E-E’ using ImageJ. *p<0.05, **p<0.001, ***p<0.0001, One-Way ANOVA. Each data point represents one biological repeat (n=3), error bars are standard deviation,
    Flag F1804 200ug, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+f1804/HSP+90%CE%B1%2F%CE%B2+Antibody/bio_rxiv__2025__09__25__677354-172-29-28
    Average 96 stars, based on 1 article reviews
    flag f1804 200ug - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    Image Search Results


    CRISPR DDR library screening identifies the synthetic lethal effect between SETX and the SMC5/6 complex. ( A ) DDR screening results from MAGeCK analysis as described in the “Materials and methods” section. Genes are ranked by the RRA score of negative selection. ( B, C ) U2OS WT cells were infected with lentivirus encoding shRNA to knock down indicated genes. Three days after infection, cells were resuspended and seeded on new plates for colony formation assay (top) and monitoring growth speed (bottom). ( D ) U2OS WT cells were infected with shRNA-expressing lentivirus to deplete the indicated proteins. Three days after infection, cells were subjected to immunostaining with antibody against γH2AX. ( E ). U2OS WT cells with or without RNaseH1 expression were infected with SETX shRNA and SMC5 shRNA. Three days after infection, cells were subjected to immunostaining with antibody against γH2AX. ( F ). U2OS WT and SETX -KO cells were infected with SMC5 shRNA or vector. Three days after infection, cells were subjected to quantitative image-based cytometry (QIBC) analysis described in the “Materials and methods” section. The γH2AX level was displayed in different cell cycles (left). The percentage of cells with medium and high γH2AX signal was calculated and normalized to WT + vector control (right).

    Journal: Nucleic Acids Research

    Article Title: The SMC5/SMC6 complex is critical for resolving R-loop-induced transcription–replication conflicts

    doi: 10.1093/nar/gkaf1537

    Figure Lengend Snippet: CRISPR DDR library screening identifies the synthetic lethal effect between SETX and the SMC5/6 complex. ( A ) DDR screening results from MAGeCK analysis as described in the “Materials and methods” section. Genes are ranked by the RRA score of negative selection. ( B, C ) U2OS WT cells were infected with lentivirus encoding shRNA to knock down indicated genes. Three days after infection, cells were resuspended and seeded on new plates for colony formation assay (top) and monitoring growth speed (bottom). ( D ) U2OS WT cells were infected with shRNA-expressing lentivirus to deplete the indicated proteins. Three days after infection, cells were subjected to immunostaining with antibody against γH2AX. ( E ). U2OS WT cells with or without RNaseH1 expression were infected with SETX shRNA and SMC5 shRNA. Three days after infection, cells were subjected to immunostaining with antibody against γH2AX. ( F ). U2OS WT and SETX -KO cells were infected with SMC5 shRNA or vector. Three days after infection, cells were subjected to quantitative image-based cytometry (QIBC) analysis described in the “Materials and methods” section. The γH2AX level was displayed in different cell cycles (left). The percentage of cells with medium and high γH2AX signal was calculated and normalized to WT + vector control (right).

    Article Snippet: Antibodies used for western blotting were listed below: γH2AX (07164, Upstate), FLAG (F1804, Sigma–Aldrich), SMC5 (sc-393282, Santa Cruz), SETX (NB100-57542, Novus Biologicals), KU70 (sc-17789, Santa Cruz), V5 ( R96025 , Invitrogen), and TOP3A (kindly provided by Dr Ian David Hickson).

    Techniques: CRISPR, Library Screening, Selection, Infection, shRNA, Knockdown, Colony Assay, Expressing, Immunostaining, Plasmid Preparation, Cytometry, Control

    SMC5/6 is recruited to the sites of TRC in proximity to SETX and plays an important role in suppressing TRC. ( A, B, C, D, E ) U2OS WT cells were treated with vehicle or HU (2 mM) for 2 h and then subjected to PLA analysis showing colocalization between SETX and R-loops (A), SETX and PCNA (B), SETX and FANCD2 (C), SMC5-Flag and R-loop (D, left), SMC5-Flag and FANCD2 (D, right), and SMC5-Flag and SETX (E). ( F ) U2OS WT and SETX -KO cells with or without RNaseH1 expression were subjected to PLA analysis showing colocalization between replication (PCNA) and transcription (pPOLR2A). ( G ) U2OS WT and SETX -KO cells, with or without RNaseH1 expression, were subjected to PLA analysis showing colocalization between SMC5-Flag and R-loops (S9.6). ( H ) U2OS WT and SETX -KO cells with or without RNaseH1 expression were subjected to PLA analysis showing colocalization between SMC5-Flag and FANCD2. ( I ) U2OS WT and SETX -KO cells were infected with SMC5 shRNA or vector, with or without RNaseH1 expression. Three days after infection, cells were used for PLA analysis showing colocalization between replication (PCNA) and transcription (pPOLR2A).

    Journal: Nucleic Acids Research

    Article Title: The SMC5/SMC6 complex is critical for resolving R-loop-induced transcription–replication conflicts

    doi: 10.1093/nar/gkaf1537

    Figure Lengend Snippet: SMC5/6 is recruited to the sites of TRC in proximity to SETX and plays an important role in suppressing TRC. ( A, B, C, D, E ) U2OS WT cells were treated with vehicle or HU (2 mM) for 2 h and then subjected to PLA analysis showing colocalization between SETX and R-loops (A), SETX and PCNA (B), SETX and FANCD2 (C), SMC5-Flag and R-loop (D, left), SMC5-Flag and FANCD2 (D, right), and SMC5-Flag and SETX (E). ( F ) U2OS WT and SETX -KO cells with or without RNaseH1 expression were subjected to PLA analysis showing colocalization between replication (PCNA) and transcription (pPOLR2A). ( G ) U2OS WT and SETX -KO cells, with or without RNaseH1 expression, were subjected to PLA analysis showing colocalization between SMC5-Flag and R-loops (S9.6). ( H ) U2OS WT and SETX -KO cells with or without RNaseH1 expression were subjected to PLA analysis showing colocalization between SMC5-Flag and FANCD2. ( I ) U2OS WT and SETX -KO cells were infected with SMC5 shRNA or vector, with or without RNaseH1 expression. Three days after infection, cells were used for PLA analysis showing colocalization between replication (PCNA) and transcription (pPOLR2A).

    Article Snippet: Antibodies used for western blotting were listed below: γH2AX (07164, Upstate), FLAG (F1804, Sigma–Aldrich), SMC5 (sc-393282, Santa Cruz), SETX (NB100-57542, Novus Biologicals), KU70 (sc-17789, Santa Cruz), V5 ( R96025 , Invitrogen), and TOP3A (kindly provided by Dr Ian David Hickson).

    Techniques: Expressing, Infection, shRNA, Plasmid Preparation

    SMC5/6 is required for recruitment of BLM/TOP3A/RMI (BTRR) complex to TRC. ( A, B, C, D ) U2OS WT and SETX -KO cells with or without RNASEH1 expression were subjected to PLA analysis showing colocalization between TOP3A and FANCD2 (A), TOP3A and SMC5-Flag (B left), TOP3A and R-loops (B right), BLM and SMC5-Flag (C left), RMI1 and SMC5-Flag (C right), BLM and R-loops (D left), and RMI1 and R-loops (D right). ( E ) U2OS SETX -KO cells were infected with SMC5 shRNA or vector. Three days after infection, cells were used for PLA analysis showing colocalization between BLM and R-loops (left), TOP3A and R-loops (middle), and RMI1 and R-loops (right). ( F ) U2OS WT cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were used for PLA analysis showing colocalization between SMC5-Flag and R-loops (S9.6). ( G ) U2OS WT cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were subjected to PLA analysis showing colocalization between replication (PCNA) and transcription (pPOLR2A).

    Journal: Nucleic Acids Research

    Article Title: The SMC5/SMC6 complex is critical for resolving R-loop-induced transcription–replication conflicts

    doi: 10.1093/nar/gkaf1537

    Figure Lengend Snippet: SMC5/6 is required for recruitment of BLM/TOP3A/RMI (BTRR) complex to TRC. ( A, B, C, D ) U2OS WT and SETX -KO cells with or without RNASEH1 expression were subjected to PLA analysis showing colocalization between TOP3A and FANCD2 (A), TOP3A and SMC5-Flag (B left), TOP3A and R-loops (B right), BLM and SMC5-Flag (C left), RMI1 and SMC5-Flag (C right), BLM and R-loops (D left), and RMI1 and R-loops (D right). ( E ) U2OS SETX -KO cells were infected with SMC5 shRNA or vector. Three days after infection, cells were used for PLA analysis showing colocalization between BLM and R-loops (left), TOP3A and R-loops (middle), and RMI1 and R-loops (right). ( F ) U2OS WT cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were used for PLA analysis showing colocalization between SMC5-Flag and R-loops (S9.6). ( G ) U2OS WT cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were subjected to PLA analysis showing colocalization between replication (PCNA) and transcription (pPOLR2A).

    Article Snippet: Antibodies used for western blotting were listed below: γH2AX (07164, Upstate), FLAG (F1804, Sigma–Aldrich), SMC5 (sc-393282, Santa Cruz), SETX (NB100-57542, Novus Biologicals), KU70 (sc-17789, Santa Cruz), V5 ( R96025 , Invitrogen), and TOP3A (kindly provided by Dr Ian David Hickson).

    Techniques: Expressing, Infection, shRNA, Plasmid Preparation, Knockdown

    BTRR is important for reducing supercoils at TRCs and exhibits a synthetic lethal interaction with SETX. ( A ) U2OS WT and SETX -KO cells were infected with SMC5 shRNA or vector. Three days after infection, cells were subjected to PLA analysis showing colocalization between TOP2A and R-loops (S9.6). ( B ) U2OS SETX -KO cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were subjected to PLA analysis showing colocalization between TOP2A and R-loops (S9.6). ( C ) U2OS SETX -KO cells were infected with lentivirus to express TOP3A-WT or Y362F mutant. Then, cells were infected with TOP3A shRNA or vector. Three days after shRNA infection, cells were subjected to PLA analysis showing colocalization between TOP2A and R-loops (S9.6). ( D ) U2OS WT cells were infected with shRNA-expressing lentivirus to knock down indicated genes. Three days after infection, cells were subjected to immunostaining with antibody against γH2AX. ( E ) U2OS WT cells were infected with shRNA-expressing lentivirus to knock down indicated genes. Three days after infection, cells were resuspended and seeded on plates for colony formation assay.

    Journal: Nucleic Acids Research

    Article Title: The SMC5/SMC6 complex is critical for resolving R-loop-induced transcription–replication conflicts

    doi: 10.1093/nar/gkaf1537

    Figure Lengend Snippet: BTRR is important for reducing supercoils at TRCs and exhibits a synthetic lethal interaction with SETX. ( A ) U2OS WT and SETX -KO cells were infected with SMC5 shRNA or vector. Three days after infection, cells were subjected to PLA analysis showing colocalization between TOP2A and R-loops (S9.6). ( B ) U2OS SETX -KO cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were subjected to PLA analysis showing colocalization between TOP2A and R-loops (S9.6). ( C ) U2OS SETX -KO cells were infected with lentivirus to express TOP3A-WT or Y362F mutant. Then, cells were infected with TOP3A shRNA or vector. Three days after shRNA infection, cells were subjected to PLA analysis showing colocalization between TOP2A and R-loops (S9.6). ( D ) U2OS WT cells were infected with shRNA-expressing lentivirus to knock down indicated genes. Three days after infection, cells were subjected to immunostaining with antibody against γH2AX. ( E ) U2OS WT cells were infected with shRNA-expressing lentivirus to knock down indicated genes. Three days after infection, cells were resuspended and seeded on plates for colony formation assay.

    Article Snippet: Antibodies used for western blotting were listed below: γH2AX (07164, Upstate), FLAG (F1804, Sigma–Aldrich), SMC5 (sc-393282, Santa Cruz), SETX (NB100-57542, Novus Biologicals), KU70 (sc-17789, Santa Cruz), V5 ( R96025 , Invitrogen), and TOP3A (kindly provided by Dr Ian David Hickson).

    Techniques: Infection, shRNA, Plasmid Preparation, Knockdown, Mutagenesis, Expressing, Immunostaining, Colony Assay

    SLF2 is required for SMC5/6 loading to TRCs upon SETX loss. ( A ) U2OS SETX-KO cells were infected with SLF2 shRNA or vector. Three days after infection, cells were subjected to PLA analysis showing colocalization between SMC5-Flag and FANCD2. ( B ) U2OS WT cells were infected with SLF2 shRNA or vector. Three days after infection, cells were subjected to PLA analysis showing colocalization between replication (PCNA) and transcription (pPOLR2A). ( C ) U2OS WT and SLF2 -KO cells were infected with SETX shRNA or vector. Three days after infection, cells were harvested for western blotting using the antibodies indicated. ( D ) U2OS WT cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were resuspended and seeded on new plates for colony formation assay (left) and monitoring growth speed (right).

    Journal: Nucleic Acids Research

    Article Title: The SMC5/SMC6 complex is critical for resolving R-loop-induced transcription–replication conflicts

    doi: 10.1093/nar/gkaf1537

    Figure Lengend Snippet: SLF2 is required for SMC5/6 loading to TRCs upon SETX loss. ( A ) U2OS SETX-KO cells were infected with SLF2 shRNA or vector. Three days after infection, cells were subjected to PLA analysis showing colocalization between SMC5-Flag and FANCD2. ( B ) U2OS WT cells were infected with SLF2 shRNA or vector. Three days after infection, cells were subjected to PLA analysis showing colocalization between replication (PCNA) and transcription (pPOLR2A). ( C ) U2OS WT and SLF2 -KO cells were infected with SETX shRNA or vector. Three days after infection, cells were harvested for western blotting using the antibodies indicated. ( D ) U2OS WT cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were resuspended and seeded on new plates for colony formation assay (left) and monitoring growth speed (right).

    Article Snippet: Antibodies used for western blotting were listed below: γH2AX (07164, Upstate), FLAG (F1804, Sigma–Aldrich), SMC5 (sc-393282, Santa Cruz), SETX (NB100-57542, Novus Biologicals), KU70 (sc-17789, Santa Cruz), V5 ( R96025 , Invitrogen), and TOP3A (kindly provided by Dr Ian David Hickson).

    Techniques: Infection, shRNA, Plasmid Preparation, Western Blot, Knockdown, Colony Assay

    FANCD2 activation depends on BTRR. ( A ) U2OS WT and SETX -KO cells with or without RNASEH1 expression were used for immunostaining with antibody against FANCD2. ( B ) SMC6-Flag-expressing U2OS WT and SETX -KO cells, with or without RNaseH1 expression, were subjected to PLA analysis showing colocalization between SMC6-Flag and FANCD2. ( C ) U2OS WT and SETX -KO cells with or without RNASEH1 expression were subjected to PLA analysis showing colocalization between BLM and FANCD2. ( D ) U2OS SETX -KO cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were used for immunostaining with an antibody against FANCD2. ( E ) U2OS WT cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were subjected to PLA analysis showing colocalization between FANCD2 and R-loops (S9.6). ( F ) U2OS WT cells were infected with FANCD2 shRNA or vector. Three days after infection, cells were subjected to PLA analysis showing colocalization between SMC5-Flag and BLM (left), SMC5-Flag and TOP3A (middle), and SMC5-Flag and RMI1 (right).

    Journal: Nucleic Acids Research

    Article Title: The SMC5/SMC6 complex is critical for resolving R-loop-induced transcription–replication conflicts

    doi: 10.1093/nar/gkaf1537

    Figure Lengend Snippet: FANCD2 activation depends on BTRR. ( A ) U2OS WT and SETX -KO cells with or without RNASEH1 expression were used for immunostaining with antibody against FANCD2. ( B ) SMC6-Flag-expressing U2OS WT and SETX -KO cells, with or without RNaseH1 expression, were subjected to PLA analysis showing colocalization between SMC6-Flag and FANCD2. ( C ) U2OS WT and SETX -KO cells with or without RNASEH1 expression were subjected to PLA analysis showing colocalization between BLM and FANCD2. ( D ) U2OS SETX -KO cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were used for immunostaining with an antibody against FANCD2. ( E ) U2OS WT cells were infected with shRNA to knock down indicated genes. Three days after infection, cells were subjected to PLA analysis showing colocalization between FANCD2 and R-loops (S9.6). ( F ) U2OS WT cells were infected with FANCD2 shRNA or vector. Three days after infection, cells were subjected to PLA analysis showing colocalization between SMC5-Flag and BLM (left), SMC5-Flag and TOP3A (middle), and SMC5-Flag and RMI1 (right).

    Article Snippet: Antibodies used for western blotting were listed below: γH2AX (07164, Upstate), FLAG (F1804, Sigma–Aldrich), SMC5 (sc-393282, Santa Cruz), SETX (NB100-57542, Novus Biologicals), KU70 (sc-17789, Santa Cruz), V5 ( R96025 , Invitrogen), and TOP3A (kindly provided by Dr Ian David Hickson).

    Techniques: Activation Assay, Expressing, Immunostaining, Infection, shRNA, Knockdown, Plasmid Preparation

    BTRR is important for recruiting FANCM to activate FANCD2 at TRCs. ( A ) U2OS WT and SETX -KO cells with Flag-FANCM expression were subjected to PLA analysis showing colocalization between SMC6 and Flag-FANCM. ( B ) U2OS SETX -KO cells were infected with FANCM shRNA or vector. Three days after infection, cells were analyzed using PLA to assess colocalization between SMC5-Flag and FANCD2 (left) or subjected to immunostaining with an anti-FANCD2 antibody (right). ( C ) U2OS SETX -KO cells with Flag-FANCM expression were infected with shRNA to knock down indicated genes. Three days after infection, cells were subjected to PLA analysis showing colocalization between SMC6 and Flag-FANCM. ( D ) U2OS SETX -KO cells expressing flag-FANCM-WT or Flag-FANCM-MM2 with silent mutations resistant to its FANCM shRNA were infected with FANCM shRNA to deplete endogenous FANCM. Three days after infection, cells were subjected to PLA analysis showing colocalization between SMC6 and Flag-FANCM. ( E ) Illustration of SMC5/6-mediated resolution of TRC in SETX-deficient cells. Positive supercoiling accumulates at TRC sites due to SETX loss. The SMC5/6 complex recognizes the supercoiling signals and recruits BTRR to relieve the tension. Meanwhile, BTRR recruits FANCM through direct interaction, ultimately activating FANCD2 to resolve TRCs.

    Journal: Nucleic Acids Research

    Article Title: The SMC5/SMC6 complex is critical for resolving R-loop-induced transcription–replication conflicts

    doi: 10.1093/nar/gkaf1537

    Figure Lengend Snippet: BTRR is important for recruiting FANCM to activate FANCD2 at TRCs. ( A ) U2OS WT and SETX -KO cells with Flag-FANCM expression were subjected to PLA analysis showing colocalization between SMC6 and Flag-FANCM. ( B ) U2OS SETX -KO cells were infected with FANCM shRNA or vector. Three days after infection, cells were analyzed using PLA to assess colocalization between SMC5-Flag and FANCD2 (left) or subjected to immunostaining with an anti-FANCD2 antibody (right). ( C ) U2OS SETX -KO cells with Flag-FANCM expression were infected with shRNA to knock down indicated genes. Three days after infection, cells were subjected to PLA analysis showing colocalization between SMC6 and Flag-FANCM. ( D ) U2OS SETX -KO cells expressing flag-FANCM-WT or Flag-FANCM-MM2 with silent mutations resistant to its FANCM shRNA were infected with FANCM shRNA to deplete endogenous FANCM. Three days after infection, cells were subjected to PLA analysis showing colocalization between SMC6 and Flag-FANCM. ( E ) Illustration of SMC5/6-mediated resolution of TRC in SETX-deficient cells. Positive supercoiling accumulates at TRC sites due to SETX loss. The SMC5/6 complex recognizes the supercoiling signals and recruits BTRR to relieve the tension. Meanwhile, BTRR recruits FANCM through direct interaction, ultimately activating FANCD2 to resolve TRCs.

    Article Snippet: Antibodies used for western blotting were listed below: γH2AX (07164, Upstate), FLAG (F1804, Sigma–Aldrich), SMC5 (sc-393282, Santa Cruz), SETX (NB100-57542, Novus Biologicals), KU70 (sc-17789, Santa Cruz), V5 ( R96025 , Invitrogen), and TOP3A (kindly provided by Dr Ian David Hickson).

    Techniques: Expressing, Infection, shRNA, Plasmid Preparation, Immunostaining, Knockdown

    (A) U2OS WT and SETX -KO cells expressing Flag-PIF1, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B and C) U2OS WT and SETX -KO cells, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of PCNA (B) or ubiquitinated PCNA (C) with γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (E and F) U2OS SETX -KO cells expressing FLAG-PIF1 were infected with lentiviruses encoding shRNA-resistant PCNA-WT or PCNA-K164R. All cells were further infected with PCNA shRNA to deplete endogenous PCNA. Three days after PCNA knockdown, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of FLAG-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (G) U2OS SETX -KO cells with FLAG-PIF1 expression were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (H) U2OS SETX -KO EGFP-BIR reporter cells were infected with lentiviruses to express shRNA-resistant PCNA-WT or PCNA-K164R. Control cells and PCNA-expressing cells were infected with PCNA shRNA or vector. Three days later, all cells were infected with I-SceI-expressing lentiviruses to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after I-SceI induction, and data are shown as mean ± SD of n = 3 biological replicates.

    Journal: Cell reports

    Article Title: Break-induced replication is activated to repair R-loop-associated double-strand breaks in SETX-deficient cells

    doi: 10.1016/j.celrep.2025.116386

    Figure Lengend Snippet: (A) U2OS WT and SETX -KO cells expressing Flag-PIF1, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B and C) U2OS WT and SETX -KO cells, with or without RNASEH1 expression, were treated with IR (4 Gy). Two hours later, the co-localization of PCNA (B) or ubiquitinated PCNA (C) with γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (E and F) U2OS SETX -KO cells expressing FLAG-PIF1 were infected with lentiviruses encoding shRNA-resistant PCNA-WT or PCNA-K164R. All cells were further infected with PCNA shRNA to deplete endogenous PCNA. Three days after PCNA knockdown, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of FLAG-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (G) U2OS SETX -KO cells with FLAG-PIF1 expression were treated with DMSO or 20 μM DRB for 16 h prior to IR (4 Gy). Two hours after IR, the co-localization of Flag-PIF1 and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (H) U2OS SETX -KO EGFP-BIR reporter cells were infected with lentiviruses to express shRNA-resistant PCNA-WT or PCNA-K164R. Control cells and PCNA-expressing cells were infected with PCNA shRNA or vector. Three days later, all cells were infected with I-SceI-expressing lentiviruses to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after I-SceI induction, and data are shown as mean ± SD of n = 3 biological replicates.

    Article Snippet: Primary antibodies used were as follows: FLAG (F1804, Sigma-Aldrich), PCNA (SC-56, Santa Cruz), γH2AX (07164, Upstate) and PCNA-Ub (13439, Cell Signaling Technology), DNA polymerase α (sc-137021, Santa Cruz).

    Techniques: Expressing, Infection, shRNA, Knockdown, Control, Plasmid Preparation

    (A) U2OS WT and SETX -KO cells were infected with PRIM1 shRNA or vector. Three days later, cells were treated with IR (4 Gy) (left). U2OS WT and SETX -KO cells were treated with DMSO or CD437 (10 μM) prior to IR (4 Gy) (right). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B) U2OS SETX -KO cells were infected with the indicated shRNA or vector. Three days later, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (C) U2OS WT and SETX -KO cells (left), and SETX -KO cells infected with indicated shRNAs (right) were treated with IR (4 Gy). Two hours later, the co-localization of Polα and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells expressing Flag-PIF1, with or without RNASEH1 expression, were infected with XPF shRNA or vector. Three days later, all cells were treated with IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX (left) and the co-localization of FLAG-PIF1 and γ-H2AX (right) were analyzed by PLA. Data are shown as the mean of n = 100 cells. (E) U2OS EGFP-HR reporter cells were infected with vector, XPF shRNA, SETX shRNA, or both XPF shRNA and SETX shRNA. Three days later, cells were infected with lentiviruses expressing I-SceI to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after DSB induction; data are shown as mean ± SD of n = 3 biological replicates. (F) U2OS EGFP-HR reporter cells with or without RNASEH1 expression were infected with the indicated shRNAs. Three days later, cells were infected with lentiviruses expressing I-SceI to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after DSB induction, and data are shown as mean ± SD of n = 3 biological replicates.

    Journal: Cell reports

    Article Title: Break-induced replication is activated to repair R-loop-associated double-strand breaks in SETX-deficient cells

    doi: 10.1016/j.celrep.2025.116386

    Figure Lengend Snippet: (A) U2OS WT and SETX -KO cells were infected with PRIM1 shRNA or vector. Three days later, cells were treated with IR (4 Gy) (left). U2OS WT and SETX -KO cells were treated with DMSO or CD437 (10 μM) prior to IR (4 Gy) (right). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (B) U2OS SETX -KO cells were infected with the indicated shRNA or vector. Three days later, cells were treated with IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (C) U2OS WT and SETX -KO cells (left), and SETX -KO cells infected with indicated shRNAs (right) were treated with IR (4 Gy). Two hours later, the co-localization of Polα and γ-H2AX was analyzed by PLA. Data are shown as the mean of n = 100 cells. (D) U2OS SETX -KO cells expressing Flag-PIF1, with or without RNASEH1 expression, were infected with XPF shRNA or vector. Three days later, all cells were treated with IR (4 Gy). Two hours after IR, the co-localization of ubiquitinated PCNA and γ-H2AX (left) and the co-localization of FLAG-PIF1 and γ-H2AX (right) were analyzed by PLA. Data are shown as the mean of n = 100 cells. (E) U2OS EGFP-HR reporter cells were infected with vector, XPF shRNA, SETX shRNA, or both XPF shRNA and SETX shRNA. Three days later, cells were infected with lentiviruses expressing I-SceI to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after DSB induction; data are shown as mean ± SD of n = 3 biological replicates. (F) U2OS EGFP-HR reporter cells with or without RNASEH1 expression were infected with the indicated shRNAs. Three days later, cells were infected with lentiviruses expressing I-SceI to induce DSBs. The percentage of EGFP-positive cells was quantified by FACS analysis 5 days after DSB induction, and data are shown as mean ± SD of n = 3 biological replicates.

    Article Snippet: Primary antibodies used were as follows: FLAG (F1804, Sigma-Aldrich), PCNA (SC-56, Santa Cruz), γH2AX (07164, Upstate) and PCNA-Ub (13439, Cell Signaling Technology), DNA polymerase α (sc-137021, Santa Cruz).

    Techniques: Infection, shRNA, Plasmid Preparation, Expressing

    (A-A’) Immunoprecipitation of GSK3α/β-Flag with ALK WT , probed with anti-Flag (GSK3α/β) and anti-ALK. n=3 (B-B’) Immunoprecipitation of ALK-Flag with either GSK3α or GSK3β, 24h after cells were treated with 0.5μM crizotinib (CTN). DMSO was used as controls. Probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (C-D) Quantification of B-B’ using ImageJ. (E-G) Immunoprecipitation of ALK WT -Flag, ALK I1250T -Flag (kinase-dead), ALK F1174L -Flag, or ALK R1275Q -Flag with either GSK3α or GSK3β, probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (F-G) Quantification of E-E’ using ImageJ. *p<0.05, **p<0.001, ***p<0.0001, One-Way ANOVA. Each data point represents one biological repeat (n=3), error bars are standard deviation,

    Journal: bioRxiv

    Article Title: Neuroblastoma-associated ALK variants have distinct cellular and biochemical activities

    doi: 10.1101/2025.09.25.677354

    Figure Lengend Snippet: (A-A’) Immunoprecipitation of GSK3α/β-Flag with ALK WT , probed with anti-Flag (GSK3α/β) and anti-ALK. n=3 (B-B’) Immunoprecipitation of ALK-Flag with either GSK3α or GSK3β, 24h after cells were treated with 0.5μM crizotinib (CTN). DMSO was used as controls. Probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (C-D) Quantification of B-B’ using ImageJ. (E-G) Immunoprecipitation of ALK WT -Flag, ALK I1250T -Flag (kinase-dead), ALK F1174L -Flag, or ALK R1275Q -Flag with either GSK3α or GSK3β, probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (F-G) Quantification of E-E’ using ImageJ. *p<0.05, **p<0.001, ***p<0.0001, One-Way ANOVA. Each data point represents one biological repeat (n=3), error bars are standard deviation,

    Article Snippet: All primary antibodies were diluted 1:1000; ALK (CST, 3633T), p(Y1507)ALK (CST, 14678), Flag (Sigma, F1804-200UG), GFP (CST, 2956), GSK3α (CST, 9338), GSK3β (CST, 9315), GSK3α/β (CST, 5676), HSP90 (Santa Cruz, SC-13119).

    Techniques: Immunoprecipitation, Standard Deviation

    (A-A’) Immunoprecipitation of GSK3α/β-Flag with ALK WT , probed with anti-Flag (GSK3α/β) and anti-ALK. n=3 (B-B’) Immunoprecipitation of ALK-Flag with either GSK3α or GSK3β, 24h after cells were treated with 0.5μM crizotinib (CTN). DMSO was used as controls. Probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (C-D) Quantification of B-B’ using ImageJ. (E-G) Immunoprecipitation of ALK WT -Flag, ALK I1250T -Flag (kinase-dead), ALK F1174L -Flag, or ALK R1275Q -Flag with either GSK3α or GSK3β, probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (F-G) Quantification of E-E’ using ImageJ. *p<0.05, **p<0.001, ***p<0.0001, One-Way ANOVA. Each data point represents one biological repeat (n=3), error bars are standard deviation,

    Journal: bioRxiv

    Article Title: Neuroblastoma-associated ALK variants have distinct cellular and biochemical activities

    doi: 10.1101/2025.09.25.677354

    Figure Lengend Snippet: (A-A’) Immunoprecipitation of GSK3α/β-Flag with ALK WT , probed with anti-Flag (GSK3α/β) and anti-ALK. n=3 (B-B’) Immunoprecipitation of ALK-Flag with either GSK3α or GSK3β, 24h after cells were treated with 0.5μM crizotinib (CTN). DMSO was used as controls. Probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (C-D) Quantification of B-B’ using ImageJ. (E-G) Immunoprecipitation of ALK WT -Flag, ALK I1250T -Flag (kinase-dead), ALK F1174L -Flag, or ALK R1275Q -Flag with either GSK3α or GSK3β, probed with anti-Flag (ALK), anti-p(Y1507)ALK (active ALK), anti-GSK3α, and anti-GSK3β. (F-G) Quantification of E-E’ using ImageJ. *p<0.05, **p<0.001, ***p<0.0001, One-Way ANOVA. Each data point represents one biological repeat (n=3), error bars are standard deviation,

    Article Snippet: All primary antibodies were diluted 1:1000; ALK (CST, 3633T), p(Y1507)ALK (CST, 14678), Flag (Sigma, F1804-200UG), GFP (CST, 2956), GSK3α (CST, 9338), GSK3β (CST, 9315), GSK3α/β (CST, 5676), HSP90 (Santa Cruz, SC-13119).

    Techniques: Immunoprecipitation, Standard Deviation